Universal cpSSR primers
Weising K, Gardner RC (1999) A set of conserved PCR primers for the analysis of simple sequence repeat polymorphisms in chloroplast genomes of dicotyledonous angiosperms. Genome 42(1):9-19

Primer name Primer sequence Length in bases Exp. annealing temperature Allele size range in Angiosperms
ccmp1 [F] caggtaaacttctcaacgga 20 50 122-143
ccmp1 [R] ccgaagtcaaaagagcgatt 20  
ccmp2 [F] gatcccggacgtaatcctg 19 50 166-234
ccmp2 [R] atcgtaccgagggttcgaat 20  
ccmp3 [F] cagaccaaaagctgacatag 20 50 89-119
ccmp3 [R] gtttcattcggctcctttat 20  
ccmp4 [F] aatgctgaatcgaygaccta 20 50 115-220
ccmp4 [R] ccaaaatattbggaggactct 21  
ccmp5 [F] tgttccaatatcttcttgtcattt 24 50 77-145
ccmp5 [R] aggttccatcggaacaattat 21  
ccmp6 [F] cgatgcatatgtagaaagcc 20 50 93-111
ccmp6 [R] cattacgtgcgactatctcc 20  
ccmp7 [F] caacatataccactgtcaag 20 50 129-151
ccmp7 [R] acatcattattgtatactctttc 23  
ccmp8 [F] ttggctactctaaccttccc 20 50 65-77
ccmp8 R] ttctttcttatttcgcagdgaa 22  
ccmp9 [F] ggatttgtacatataggaca 20 50 96-104
ccmp9 [R] ctcaactctaagaaatacttg 21  
ccmp10 [F] tttttttttagtgaacgtgtca 22 50 91-300
ccmp10 [R] ttcgtcgdcgtagtaaatag 20  
back

©The Greek Vitis Database:
A multimedia web-backed genetic database for germplasm management of Vitis resources in Greece.
By Francois LEFORT and Kalliopi A. ROUBELAKIS-ANGELAKIS
Laboratory of Plant Physiology and Biotechnology,Department of Biology, University of Crete, Heraklion, Crete, Greece